../../tmp/servers/virsirnadb/1225103227
Result for your query siRNA sequence
| RED | =100 % Complementary sequence |
| . | =Identical residue |
| blue alphabets | =mismatch |
| _ | =Gap |
| Acc number | Strain name | Start | Alignment | End | % Identity |
| Query | virsi2316 | 1 | gtttattaacactgttttgaa | 21 | |
| AY112987.1 | Semliki forest virus strain L10, complete genome | 6845 | ..................... | 6865 | 100 |
| AY112987.1 | Semliki forest virus strain L10, complete genome | 2400 | _________.........___ | 2392 | 42 |
| DQ189082.1 | Semliki forest virus isolate ts10 mutant polyprotein nsP1234 and stru | 6762 | ..................... | 6782 | 100 |
| DQ189082.1 | Semliki forest virus isolate ts10 mutant polyprotein nsP1234 and stru | 2313 | _________.........___ | 2305 | 42 |
| DQ189084.1 | Semliki forest virus isolate ts13 mutant polyprotein nsP1234 and stru | 6762 | ..................... | 6782 | 100 |
| DQ189084.1 | Semliki forest virus isolate ts13 mutant polyprotein nsP1234 and stru | 2313 | _________.........___ | 2305 | 42 |
| DQ189086.1 | Semliki forest virus polyprotein nsP1234 and structural polyprotein g | 6762 | ..................... | 6782 | 100 |
| DQ189086.1 | Semliki forest virus polyprotein nsP1234 and structural polyprotein g | 2313 | _________.........___ | 2305 | 42 |
| EU350586.1 | Semliki forest virus from Viet Nam, complete genome | 6969 | ..................... | 6989 | 100 |
| EU350586.1 | Semliki forest virus from Viet Nam, complete genome | 2520 | _________.........___ | 2512 | 42 |
| NC_003215.1 | Semliki forest virus, complete genome | 6844 | ..................... | 6864 | 100 |
| NC_003215.1 | Semliki forest virus, complete genome | 2399 | _________.........___ | 2391 | 42 |
| Z48163.2 | Semliki forest virus genomic RNA for non-structural polyprotein and s | 6826 | ...c................. | 6846 | 95 |
| Z48163.2 | Semliki forest virus genomic RNA for non-structural polyprotein and s | 2398 | _________.........___ | 2390 | 42 |